pSLHDR_R1
(Plasmid
#124209)
-
PurposegRNA/Cas9 expression for 2nd editing using pSLHDR01, 02
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceAGCGCACTGCCGCTCATCGA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLHDR_R1 was a gift from Matthew Porteus (Addgene plasmid # 124209 ; http://n2t.net/addgene:124209 ; RRID:Addgene_124209) -
For your References section:
Efficient scarless genome editing in human pluripotent stem cells. Ikeda K, Uchida N, Nishimura T, White J, Martin RM, Nakauchi H, Sebastiano V, Weinberg KI, Porteus MH. Nat Methods. 2018 Dec;15(12):1045-1047. doi: 10.1038/s41592-018-0212-y. Epub 2018 Nov 30. 10.1038/s41592-018-0212-y PubMed 30504872