pEF1a_ TET1 CXXC only
(Plasmid #124084)

• Purpose: Expression of CXXC domain only form of TET1
• Depositing Lab: Silvia Monticelli
• Publication: Vincenzetti et al Eur J Immunol. 2019 Jan 30. doi: 10.1002/eji.201847967.

Backbone

• Vector backbone: pEF1 alpha
• Backbone size w/o insert (bp): 6112
• Total vector size (bp): 10519
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TET1 - CXXC domain
• Alt name: Ten Eleven Translocation methylcytosine dioxygenase 1
• Species: H. sapiens (human)
• Insert Size (bp): 4407
• Entrez Gene: TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
• Promoter: EF1 alpha
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid expressing wild type full length form of TET1 was taken from addgene (#49792)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry