pEF1a_CD MUT TET1
(Plasmid #124083)

• Purpose: Expression of mutated catalytic domain only form of TET1
• Depositing Lab: Silvia Monticelli
• Publication: Vincenzetti et al Eur J Immunol. 2019 Jan 30. doi: 10.1002/eji.201847967.

Backbone

• Vector backbone: pEF1 alpha
• Backbone size w/o insert (bp): 6181
• Total vector size (bp): 8857
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TET1 - catalytic domain mutated
• Alt name: Ten Eleven Translocation methylcytosine dioxygenase 1
• Species: H. sapiens (human)
• Insert Size (bp): 2676
• Mutation: H1672Y, D1674A
• Entrez Gene: TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
• Promoter: EF1 alpha
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid expressing wild type full length form of TET1 was taken from addgene (#49792)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The two mutations listed before (H1672Y, D1674A) were introduced using the
QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies).