Skip to main content
Addgene

pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40]
(Plasmid #124068)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124068 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pJET1.2
  • Backbone size w/o insert (bp) 2990
  • Total vector size (bp) 6851
  • Vector type
    Insect Expression, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eb-Tc’bhsp-EGFP-2A-Cre; 3xP3-gTc’v-SV40
  • Insert Size (bp)
    3861
  • Promoter bhsp68

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer GAAGAACATCGATTTTCCATGGC
  • 3′ sequencing primer TAATACGACTCACTATAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40] was a gift from Gregor Bucher (Addgene plasmid # 124068 ; http://n2t.net/addgene:124068 ; RRID:Addgene_124068)

  • For your References section:

    An ancestral apical brain region contributes to the central complex under the control of foxQ2 in the beetle Tribolium. He B, Buescher M, Farnworth MS, Strobl F, Stelzer EH, Koniszewski ND, Muehlen D, Bucher G. Elife. 2019 Oct 18;8. pii: 49065. doi: 10.7554/eLife.49065. 10.7554/eLife.49065 PubMed 31625505
Related items: