pSLHDR03_mCherry_tCD19_unique guide
(Plasmid #124062)

• Purpose: Construction of 1st donor for scarless genome editing with unique guide
• Depositing Lab: Matthew Porteus
• Publication: Ikeda et al Nat Methods. 2018 Dec;15(12):1045-1047. doi: 10.1038/s41592-018-0212-y. Epub 2018 Nov 30.

Backbone

• Vector backbone: Original
• Backbone size w/o insert (bp): 2541
• Total vector size (bp): 5865
• Vector type: Mouse Targeting ; Human Targeting
• Selectable markers: mCherry, tCD19

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 708
• Promoter: Human UbC modified

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCCCACAACGAGGACTACAC
• 3′ sequencing primer: ccctcATTCTTGGGGTTGAGC

Gene/Insert 2

• Gene/Insert name: tCD19
• Species: Synthetic
• Insert Size (bp): 1002
• Promoter: Human UbC modified

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGTGTTAGACTAGTAAATTGTCCGC
• 3′ sequencing primer: CTCCCACAACGAGGACTACAC

Resource Information

• Supplemental Documents:
  • pslhdr03_mcherry_tcd19_unique-guide.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry