Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKM50
(Plasmid #123656)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123656 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRL-TK-Renilla
  • Backbone manufacturer
    Promega (Madison, WI USA)
  • Backbone size w/o insert (bp) 3023
  • Total vector size (bp) 3485
  • Vector type
    Insect Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Aedes aegypti UbL40 promoter
  • Species
    Aedes aegypti
  • Insert Size (bp)
    462
  • Promoter UbL40 promoter

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gaaacgcctggtatctttata
  • 3′ sequencing primer tgtcgccataaataagaagag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSLfa-UbL40-EGFP (Raul Andino, University of California, San Francisco, CA USA) and pRL-TK-Renilla (Promega, Madison, WI USA)
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The constitutive Renilla luciferase expression plasmid pKM50 was generated in-house by amplifying the Aedes aegypti ubiquitin UbL40 promoter from pSLfa-UbL40-EGFP (a kind gift from Raul Andino, University of California, San Francisco, CA USA) and cloned by In-Fusion (Takara Biosciences, Mountain View, CA USA) into pRL-TK-Renilla (Promega, Madison, WI USA) after the TK promoter was removed by digestion with BglII and BstBI.

Please visit https://www.biorxiv.org/content/10.1101/596205v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM50 was a gift from Kevin Maringer (Addgene plasmid # 123656 ; http://n2t.net/addgene:123656 ; RRID:Addgene_123656)
  • For your References section:

    Aedes aegypti (Aag2)-derived clonal mosquito cell lines reveal the effects of pre-existing persistent infection with the insect-specific bunyavirus Phasi Charoen-like virus on arbovirus replication. Fredericks AC, Russell TA, Wallace LE, Davidson AD, Fernandez-Sesma A, Maringer K. PLoS Negl Trop Dis. 2019 Nov 6;13(11):e0007346. doi: 10.1371/journal.pntd.0007346. eCollection 2019 Nov. 10.1371/journal.pntd.0007346 PubMed 31693659