pKM19
(Plasmid #123655)

• Purpose: Encodes firefly luciferase under the pIEx promoter for constitutive expression in insect (e.g. Drosophila, mosquito) cells
• Depositing Lab: Kevin Maringer
• Publication: Fredericks et al PLoS Negl Trop Dis. 2019 Nov 6;13(11):e0007346. doi: 10.1371/journal.pntd.0007346. eCollection 2019 Nov.

Backbone

• Vector backbone: pIEx
• Backbone size w/o insert (bp): 3639
• Total vector size (bp): 5337
• Vector type: Insect Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Firefly luciferase
• Species: Photinus pyralis (firefly)
• Insert Size (bp): 1698
• Promoter: pIEx

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GATAACCGCGTTGGTTTTA
• 3′ sequencing primer: CCAACTCCCATTGTTATTTCTATGCA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pLUC-MCS vector (Agilent Technologies, Santa Clara, CA USA) and pIEx-EGFP (Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The constitutive firefly luciferase expression plasmid pKM19 was generated by amplifying the firefly luciferase gene from pLUC-MCS and cloning it into pIEx-EGFP (a kind gift from Doug Brackney, The Connecticut Agricultural Experiment Station, New Haven, CT USA) after the EGFP sequence was removed by digestion with XhoI and NcoI, using In-Fusion cloning (Takara Biosciences, Mountain View, CA USA).

Please visit https://www.biorxiv.org/content/10.1101/596205v1 for bioRxiv preprint.