nCas9-UGI-NLS-P2A-EGFP (pJUL1001)
(Plasmid #123611)

• Purpose: CAG promoter expression plasmid for hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (BE3 control without rAPOBEC1).
• Depositing Lab: Keith Joung
• Publication: Grunewald et al Nature. 2019 Apr 17. pii: 10.1038/s41586-019-1161-z. doi: 10.1038/s41586-019-1161-z.

Backbone

• Vector backbone: CAG
• Backbone manufacturer: pSQT817 (Addgene #53373)
• Backbone size w/o insert (bp): 4843
• Total vector size (bp): 10036
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nCas9-UGI-NLS-P2A-EGFP
• Alt name: hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP
• Species: Synthetic; Streptococcus pyogenes, Bacillus subtilis bacteriophage PBS1
• Insert Size (bp): 5193
• Mutation: D10A in SpCas9
• GenBank ID:
• Promoter: CAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTGCTAACCATGTTCATGCC
• 3′ sequencing primer: CAGAGGGAAAAAGATCTCAGTGG

Resource Information

• Supplemental Documents:
  • pJUL1001.gb
• A portion of this plasmid was derived from a plasmid made by: Liu Lab (BE3, Addgene #73021) and Benjamin Kleinstiver (BPK4335)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry