Cx36-GCaMP
(Plasmid #123604)

• Purpose: Mouse Connexin 36-GCaMP3 fusion for measuring gap junction localized calcium signaling - expresses in mammalian cells
• Depositing Lab: John O'Brien
• Publication: Moore et al eNeuro. 2020 Mar 11. pii: ENEURO.0445-19.2020. doi: 10.1523/ENEURO.0445-19.2020.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 6335
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Connexin 36-GCaMP3 fusion
• Alt name: Cx36-GCaMP
• Species: M. musculus (mouse)
• Insert Size (bp): 2513
• Entrez Gene: Gjd2 (a.k.a. Cxns, Gja9, connexin36, cx36)
• Promoter: CMV
• Tag / Fusion Protein:
  • GCaMP3 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AfeI (destroyed during cloning)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: CMV forward (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: GCaMP Rev (TGATGCCGTTCTTCTGCTTGTC)

Resource Information

• Supplemental Documents:
  • CMV-MsCx36-GCaMP3.gbk
• A portion of this plasmid was derived from a plasmid made by: Muayyad Al-Ubaidi, University of Illinois, Chicago (currently University of Houston) GCaMP3 from Loren Looger (Addgene plasmid #22692)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry