pCFD3.1-w-dU6:3gRNA
(Plasmid #123366)

• Purpose: gRNA expression plasmid for CRISPR mutagenesis in Drosophila (with mini-white transformation marker).
• Depositing Lab: Simon Bullock
• Publication: Insect expression, CRISPR (unpublished)

Backbone

• Vector backbone: pCFD3-dU6-3gRNA (Addgene 49410)
• Backbone manufacturer: Fillip Port
• Total vector size (bp): 7998
• Modifications to backbone: Replacement of vermilion transformation marker with mini-white gene (with BbsI sites mutated)
• Vector type: Insect Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: U6:3-gRNA
• Alt name: U6:3-sgRNA
• Species: D. melanogaster (fly)
• GenBank ID:

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind III (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: CTGGCGAAAGGGGGATGTGCTG
• 3′ sequencing primer: TAAGGTATGCAGGTGTGTAAGTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The modified mini-white cassette was provided by Dr Fillip Port from CRISPRflydesign, who has given permission for us to deposit this plasmid.
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When describing the use of this plasmid in publications, please state that it is derived from pCFD3 and cite:

Port et al. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):E2967-76. doi: 10.1073/pnas.1405500111

In pCFD3.1, the BbsI sites have been mutated in mini-white, which allows use of the remaining BbsI sites for gRNA cloning (using the protocol for pCFD3 (https://www.crisprflydesign.org/plasmids/))