Skip to main content
Addgene

pDB-His-MBP-mGSDMD
(Plasmid #123365)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123365 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDB-His-MBP
  • Backbone manufacturer
    Berkeley Structural Genomics Center
  • Backbone size w/o insert (bp) 6494
  • Total vector size (bp) 7958
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GSDMD
  • Alt name
    Gasdermin D
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1464
  • GenBank ID
    NP_081236.1
  • Entrez Gene
    Gsdmd (a.k.a. 1810036L03Rik, DF5L, Dfna5l, GsdmD-1, Gsdmdc1, M2-4)
  • Promoter T7
  • Tag / Fusion Protein
    • His6-MBP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CAGATGTCCGCTTTCTGGTATGCCG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDB-His-MBP-mGSDMD was a gift from Hao Wu (Addgene plasmid # 123365 ; http://n2t.net/addgene:123365 ; RRID:Addgene_123365)

  • For your References section:

    Pathogen blockade of TAK1 triggers caspase-8-dependent cleavage of gasdermin D and cell death. Orning P, Weng D, Starheim K, Ratner D, Best Z, Lee B, Brooks A, Xia S, Wu H, Kelliher MA, Berger SB, Gough PJ, Bertin J, Proulx MM, Goguen JD, Kayagaki N, Fitzgerald KA, Lien E. Science. 2018 Nov 30;362(6418):1064-1069. doi: 10.1126/science.aau2818. Epub 2018 Oct 25. 10.1126/science.aau2818 PubMed 30361383
Related items:
Commonly requested with: