pRC49-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-2A-EGFP_NLS-WPRE
(Plasmid #123363)

• Purpose: Lentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance, Firefly luciferase, and nuclear EGFP.
• Depositing Lab: Sidi Chen
• Publication: Chow et al Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8.

Backbone

• Vector backbone: pRG01
• Backbone size w/o insert (bp): 9004
• Total vector size (bp): 9823
• Modifications to backbone: Inserted P2A-EGFP_NLS after FLuc
• Vector type: Mammalian Expression, Lentiviral, CRISPR, Luciferase
• Selectable markers: Puromycin ; EGFP-NLS

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-NLS
• Alt name: Nuclear localized EGFP
• Species: Synthetic
• Insert Size (bp): 714
• Promoter: EFS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtggacgaagtaccgaaaggtcttacc
• 3′ sequencing primer: cagcgtatccacatagcgtaaaagga

Resource Information

• Supplemental Documents:
  • pRC49-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-2A-EGFP_NLS-WPRE.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry