Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRC11-U6-DR-crRNA-BsmbI(x2); EFS-Puro-WPRE
(Plasmid #123360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123360 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 8384
  • Total vector size (bp) 7289
  • Modifications to backbone
    EFS promoter to express puromycin resistance, U6 cassette exchanged to contain LbCpf1 DR sequence
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Empty LbCpf1 crRNA cloning cassette
  • Species
    Synthetic
  • Insert Size (bp)
    100
  • Promoter U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagggcctatttcccatgat
  • 3′ sequencing primer tactattctttcccctgcactgtac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRC11-U6-DR-crRNA-BsmbI(x2); EFS-Puro-WPRE was a gift from Sidi Chen (Addgene plasmid # 123360 ; http://n2t.net/addgene:123360 ; RRID:Addgene_123360)
  • For your References section:

    In vivo profiling of metastatic double knockouts through CRISPR-Cpf1 screens. Chow RD, Wang G, Ye L, Codina A, Kim HR, Shen L, Dong MB, Errami Y, Chen S. Nat Methods. 2019 May;16(5):405-408. doi: 10.1038/s41592-019-0371-5. Epub 2019 Apr 8. 10.1038/s41592-019-0371-5 PubMed 30962622