pAAV-Syn-ChromeQ-GFP
(Plasmid #123317)

• Purpose: AAV-mediated expression of ChromeQ-GFP under the Syn promoter.
• Depositing Lab: Edward Boyden
• Publication: Cho et al J Biol Chem. 2019 Jan 4. pii: RA118.006996. doi: 10.1074/jbc.RA118.006996.

Backbone

• Vector backbone: pAAV-Syn
• Backbone manufacturer: original from Stratagene
• Backbone size w/o insert (bp): 4708
• Total vector size (bp): 6373
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChromeQ-GFP
• Insert Size (bp): 1665
• Mutation: Channelrhodopsin-2 (ChR2) with mutations A71S/ E90A/H114G/R115S
• Promoter: Syn
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: ECoRI (not destroyed)
• 5′ sequencing primer: gcacgggcgcgaccatctgc
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.