Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-MA-VN
(Plasmid #123283)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123283 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Backbone manufacturer
    NIH AIDS Reagent Program (Cat. No. 11468)
  • Backbone size w/o insert (bp) 3970
  • Total vector size (bp) 4866
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Matrix
  • Alt name
    Gag p17
  • Alt name
    p17
  • Alt name
    MA
  • Species
    Human immunodeficiency virus 1
  • Insert Size (bp)
    896
  • GenBank ID
    NP_579876.2
  • Promoter CMV
  • Tag / Fusion Protein
    • VN: N-terminus of split Venus (a.a. V1–A154) I152L variant (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer SV40-pArev: CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-MA-VN was a gift from Erik Procko (Addgene plasmid # 123283 ; http://n2t.net/addgene:123283 ; RRID:Addgene_123283)
  • For your References section:

    Conformational engineering of HIV-1 Env based on mutational tolerance in the CD4 and PG16 bound states. Heredia JD, Park J, Choi H, Gill KS, Procko E. J Virol. 2019 Mar 20. pii: JVI.00219-19. doi: 10.1128/JVI.00219-19. 10.1128/JVI.00219-19 PubMed 30894475