pCMV-MA-VN
(Plasmid #123283)

• Purpose: Mammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)
• Depositing Lab: Erik Procko
• Publication: Heredia et al J Virol. 2019 Mar 20. pii: JVI.00219-19. doi: 10.1128/JVI.00219-19.

Backbone

• Vector backbone: pCMV
• Backbone manufacturer: NIH AIDS Reagent Program (Cat. No. 11468)
• Backbone size w/o insert (bp): 3970
• Total vector size (bp): 4866
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Matrix
• Alt name: Gag p17
• Alt name: p17
• Alt name: MA
• Species: Human immunodeficiency virus 1
• Insert Size (bp): 896
• GenBank ID: NP_579876.2
• Promoter: CMV
• Tag / Fusion Protein:
  • VN: N-terminus of split Venus (a.a. V1–A154) I152L variant (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CMV forward: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: SV40-pArev: CCTCTACAAATGTGGTATGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry