SiriusGFP
(Plasmid #123201)

• Purpose: We have developed a variant of eGFP, SiriusGFP, that shows over a two fold increase in photostability with utility in methods requiring sustained or high intensity excitation as in 4D confocal or SIM.
• Depositing Lab: Joseph Santos-Sacchi
• Publication: Zhong et al J Neurosci Methods. 2019 Feb 1;313:68-76. doi: 10.1016/j.jneumeth.2018.12.008. Epub 2018 Dec 19.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4016
• Total vector size (bp): 4733
• Modifications to backbone: N/A
• Vector type: Mammalian Expression, Bacterial Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SiriusGFP
• Alt name: SiriusGFP-N1
• Species: jellyfish
• Insert Size (bp): 717
• Mutation: eGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V/A206K
• Promoter: CMV
• Tags / Fusion Proteins:
  • N/A
  • N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, BamHI, AgeI, etc. (not destroyed)
• 3′ cloning site: NotI, MfeI (not destroyed)
• 5′ sequencing primer: GGTTTAGTGAACCGTCAGATCC
• 3′ sequencing primer: TGTTTCAGGTTCAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry