pXWJ109As(RS-te-AAV)
(Plasmid
#123156)
-
PurposeFor TEV-based leakiness regulation. pSB3K3 carrying J109-30arsR-t-ParsR-30hrpR-30hrpS-t-PhrpLE-30gfp-te-AAV-t
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 123156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB3K3
- Backbone size w/o insert (bp) 2750
- Total vector size (bp) 6739
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameJ109-30arsR-t-ParsR-30hrpR-30hrpS-t-PhrpLE-30gfp-te-AAV-t
-
SpeciesSynthetic
-
Insert Size (bp)3989
- Promoter J109, ParsR, PhrpLE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXWJ109As(RS-te-AAV) was a gift from Baojun Wang (Addgene plasmid # 123156 ; http://n2t.net/addgene:123156 ; RRID:Addgene_123156) -
For your References section:
Cascaded amplifying circuits enable ultrasensitive cellular sensors for toxic metals. Wan X, Volpetti F, Petrova E, French C, Maerkl SJ, Wang B. Nat Chem Biol. 2019 May;15(5):540-548. doi: 10.1038/s41589-019-0244-3. Epub 2019 Mar 25. 10.1038/s41589-019-0244-3 PubMed 30911179