As3 (pBW411J117-arsR)
(Plasmid #123142)

• Purpose: An arsenic sensor with optimized intracellular receptor density. Also used in the sensor cell array. pSB3K3 carrying J117-30arsR-t-ParsR-30gfp-t
• Depositing Lab: Baojun Wang
• Publication: Wan et al Nat Chem Biol. 2019 May;15(5):540-548. doi: 10.1038/s41589-019-0244-3. Epub 2019 Mar 25.

Backbone

• Vector backbone: pSB3K3
• Backbone size w/o insert (bp): 2750
• Total vector size (bp): 4347
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: J117-30arsR-t-ParsR-30gfp-t
• Species: Synthetic
• Insert Size (bp): 1597
• Promoter: J117, ParsR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • As3 (pBW411J117-arsR).gb
• A portion of this plasmid was derived from a plasmid made by: From Dr Baojun Wang's publication: Wang, B., Barahona, M. & Buck, M. Amplification of small molecule-inducible gene expression via tuning of intracellular receptor densities. Nucleic Acids Res. 43, 1955–1964 (2015).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry