mIL12-N1
(Plasmid #123139)

• Purpose: Mammalian expression of murine cytokine IL-12 under CMV promoter
• Depositing Lab: Jordan Green
• Publication: Tzeng et al Proc Natl Acad Sci U S A. 2020 Feb 7. pii: 1916039117. doi: 10.1073/pnas.1916039117.

Backbone

• Vector backbone: N1
• Backbone manufacturer: clonTech
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5685
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Murine IL12 tandem p40 p35
• Alt name: mIL-12
• Alt name: p40
• Alt name: p35
• Species: M. musculus (mouse)
• Insert Size (bp): 1773
• GenBank ID: 16159 16160
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: PvuI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: GATGAGTTTGGACAAACCAC

Resource Information

• Supplemental Documents:
  • mil-12-n1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry