Flag-hRPGRIP1L
(Plasmid
#122988)
-
PurposeExpresses Flag-tagged hRPGRIP1L in mammalian cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPGRIP1L
-
SpeciesH. sapiens (human)
-
Entrez GeneRPGRIP1L (a.k.a. CORS3, FTM, JBTS7, MKS5, NPHP8, PPP1R134)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hRPGRIP1L contains 4 AA changes compared to NP_056087.2 that do not impact the function of the construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-hRPGRIP1L was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122988 ; http://n2t.net/addgene:122988 ; RRID:Addgene_122988)