Skip to main content
Addgene

pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
(Plasmid #122986)

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 122986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV hSyn
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCh-IRES-SspB(micro)-BoNT/B(147-441)
  • Species
    Synthetic
  • Insert Size (bp)
    2600
  • Mutation
    SspB contains R73Q "micro" mutation, BoNT/B contains Y365A mutation
  • Promoter human synapsin
  • Tags / Fusion Proteins
    • mCh
    • mCh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer actcagcgctgcctcagt
  • 3′ sequencing primer ccacatagcgtaaaaggagcaac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SspB was obtained from Dr. Brian Kuhlman's lab (University of North Carolina, Chapel Hill) BoNT/B was a gift from Dr Thomas Binz (Hannover Medical School)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A) was a gift from Matthew Kennedy (Addgene plasmid # 122986 ; http://n2t.net/addgene:122986 ; RRID:Addgene_122986)
  • For your References section:

    A Photoactivatable Botulinum Neurotoxin for Inducible Control of Neurotransmission. Liu Q, Sinnen BL, Boxer EE, Schneider MW, Grybko MJ, Buchta WC, Gibson ES, Wysoczynski CL, Ford CP, Gottschalk A, Aoto J, Tucker CL, Kennedy MJ. Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002. 10.1016/j.neuron.2019.01.002 PubMed 30704911