pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
(Plasmid #122981)

• Purpose: AAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNT
• Depositing Lab: Matthew Kennedy
• Publication: Liu et al Neuron. 2019 Jan 15. pii: S0896-6273(19)30003-0. doi: 10.1016/j.neuron.2019.01.002.

Backbone

• Vector backbone: pAAV hSyn
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 7200
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Syph-GFP-myc-BoNT/B(1-146)-iLID
• Species: R. norvegicus (rat), Synthetic
• Insert Size (bp): 2700
• Entrez Gene: Syp (a.k.a. Syp1)
• Promoter: human synapsin
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: actcagcgctgcctcagt
• 3′ sequencing primer: ccacatagcgtaaaaggagcaac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: iLID was obtained from Dr. Brian Kuhlman, University of North Carolina Chapel Hill BoNT/B was a gift from Dr. Thomas Binz, Hannover Medical School
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry