pLenti-EF1alpha-IRES-EGFP-3XFlag-hCEP164
(Plasmid
#122966)
-
PurposeExpresses 3XFlag-tagged human CEP164 in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-EF1α-IRES-EGFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCEP164
-
SpeciesH. sapiens (human)
-
Entrez GeneCEP164 (a.k.a. NPHP15)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- 3XFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 3XFlag-hCEP164 cDNA was kindly provided by Dr. Heleen Arts at Radboud University Nijmegen Medical Centre.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EF1alpha-IRES-EGFP-3XFlag-hCEP164 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122966 ; http://n2t.net/addgene:122966 ; RRID:Addgene_122966)