pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1
(Plasmid #122964)

• Purpose: Expresses Flag-tagged Chibby1 in multiciliated cells under FoxJ1 promoter. It can be used as a cloning vector for gene of interest at SfiI sites.
• Depositing Labs: FENG-QIAN Li, Ken-Ichi Takemaru
• Publication: Expresses Flag-hChibby1 in multiciliated cells under FoxJ1 promoter (unpublished)

Backbone

• Vector backbone: pLenti-FoxJ1 promoter-IRES-EGFP
• Modifications to backbone: The original EF1α promoter in pLenti-EF1alpha-IRES-EGFP was replaced with a 1-kb human FoxJ1 promoter.
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Chibby1
• Species: H. sapiens (human)
• Entrez Gene: CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
• Promoter: human FoxJ1
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: CACCACATACTTATTCGGAG
• 3′ sequencing primer: AAGCGGCTTCGGCCAGTAAC

Resource Information

• Supplemental Documents:
  • pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The FoxJ1 promoter DNA was kindly provided by Dr. Steven Brody at Washington University.