pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-mCherry
(Plasmid
#122957)
-
PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with mCherry expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiviral
-
Backbone manufacturerDr. Cecile Charrier
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3 is also recommended.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNOTCH2NLB
-
Alt nameN2NLB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1131
-
Entrez GeneNOTCH2NLB (a.k.a. N2N, NOTCH2NL, NOTCH2NLA)
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- 6xmyc tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTACAGCTCCTGGGCAACGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-mCherry was a gift from Pierre Vanderhaeghen (Addgene plasmid # 122957 ; http://n2t.net/addgene:122957 ; RRID:Addgene_122957) -
For your References section:
Human-Specific NOTCH2NL Genes Expand Cortical Neurogenesis through Delta/Notch Regulation. Suzuki IK, Gacquer D, Van Heurck R, Kumar D, Wojno M, Bilheu A, Herpoel A, Lambert N, Cheron J, Polleux F, Detours V, Vanderhaeghen P. Cell. 2018 May 31;173(6):1370-1384.e16. doi: 10.1016/j.cell.2018.03.067. Epub 2018 May 31. 10.1016/j.cell.2018.03.067 PubMed 29856955