pCMV-M2-TLR2-P681H
(Plasmid #12290)

• Depositing Lab: Bruce Beutler
• Publication: Jiang et al Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6.

Backbone

• Vector backbone: pFlag-CMV-1
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TLR2
• Species: M. musculus (mouse)
• Insert Size (bp): 2283
• Mutation: A74V, M82I, H202Y and P681H; signal peptide (aa1-23) replaced with preprotrypsin signal peptide
• GenBank ID: NM_011905
• Entrez Gene: Tlr2 (a.k.a. Ly105)
• Tag / Fusion Protein:
  • FLAG (FLAG-M2) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not I (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: accatgtctgcacttctgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Murine TLR2 expression vector was made by removing the original signal peptide and replacing it with the signal peptide from preprotrypsin. When compared to GenBank reference NP_036035.3, the TLR2 insert in this plasmid appears to be missing aa1-23 due to the removal of the endogenous TLR2 signal peptide. See associated publication for more information.

Also, please note that Addgene's sequencing results identified additional mutations A74V, M82I and H202Y when compared to GenBank reference NP_036035.3. M82I and H202Y are possible polymorphisms as they were also present in the wild-type TLR2 sequence from the depositing laboratory (Addgene Plasmid 12291: pCMV-M2-TLR2). It is not known whether these mutations affect TLR2 function.