Skip to main content
Addgene

pCMV-M2-TLR2-P681H
(Plasmid #12290)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12290 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFlag-CMV-1
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TLR2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2283
  • Mutation
    A74V, M82I, H202Y and P681H; signal peptide (aa1-23) replaced with preprotrypsin signal peptide
  • GenBank ID
    NM_011905
  • Entrez Gene
    Tlr2 (a.k.a. Ly105)
  • Tag / Fusion Protein
    • FLAG (FLAG-M2) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not I (not destroyed)
  • 3′ cloning site Bgl II (not destroyed)
  • 5′ sequencing primer accatgtctgcacttctgatc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Murine TLR2 expression vector was made by removing the original signal peptide and replacing it with the signal peptide from preprotrypsin. When compared to GenBank reference NP_036035.3, the TLR2 insert in this plasmid appears to be missing aa1-23 due to the removal of the endogenous TLR2 signal peptide. See associated publication for more information.

Also, please note that Addgene's sequencing results identified additional mutations A74V, M82I and H202Y when compared to GenBank reference NP_036035.3. M82I and H202Y are possible polymorphisms as they were also present in the wild-type TLR2 sequence from the depositing laboratory (Addgene Plasmid 12291: pCMV-M2-TLR2). It is not known whether these mutations affect TLR2 function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-M2-TLR2-P681H was a gift from Bruce Beutler (Addgene plasmid # 12290 ; http://n2t.net/addgene:12290 ; RRID:Addgene_12290)
  • For your References section:

    Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Jiang Z, Georgel P, Li C, Choe J, Crozat K, Rutschmann S, Du X, Bigby T, Mudd S, Sovath S, Wilson IA, Olson A, Beutler B. Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6. 10.1073/pnas.0603804103 PubMed 16832055