Skip to main content
Addgene

pCMV-HA-MyD88-P200H
(Plasmid #12288)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12288 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MyD88
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    891
  • Mutation
    P200H
  • Entrez Gene
    MYD88 (a.k.a. IMD68, MYD88D, WM1)
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not I (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer ggatcctatccatatgacgtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's sequencing results indicate the MyD88 insert starts at aa15 when compared to GenBank reference sequence NP_002459.2 (MyD88 isoform 2). When numbered according to this reference sequence, the MyD88 mutation is P213H

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA-MyD88-P200H was a gift from Bruce Beutler (Addgene plasmid # 12288 ; http://n2t.net/addgene:12288 ; RRID:Addgene_12288)
  • For your References section:

    Details of Toll-like receptor:adapter interaction revealed by germ-line mutagenesis. Jiang Z, Georgel P, Li C, Choe J, Crozat K, Rutschmann S, Du X, Bigby T, Mudd S, Sovath S, Wilson IA, Olson A, Beutler B. Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6. 10.1073/pnas.0603804103 PubMed 16832055