HA-hChibby1
(Plasmid
#122873)
-
PurposeExpresses HA-tagged human Chibby1 in mammalian cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+HA
- Backbone size w/o insert (bp) 4100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Chibby1
-
SpeciesH. sapiens (human)
-
Entrez GeneCBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
- 3′ sequencing primer TTATGCTGAGTGATATC (T7) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains approximately 600bp of 3' UTR following hChibby1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-hChibby1 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122873 ; http://n2t.net/addgene:122873 ; RRID:Addgene_122873)