pCMV-HA-MyD88
(Plasmid #12287)

• Depositing Lab: Bruce Beutler
• Publication: Jiang et al Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MyD88
• Species: H. sapiens (human)
• Insert Size (bp): 891
• Entrez Gene: MYD88 (a.k.a. IMD68, MYD88D, WM1)
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not I (not destroyed)
• 3′ cloning site: Sal I (not destroyed)
• 5′ sequencing primer: ggatcctatccatatgacgtt

Resource Information

• Articles Citing this Plasmid:
  • 18 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's sequencing results indicate the MyD88 insert starts at aa15 when compared to GenBank reference sequence NP_002459.2 (MyD88 isoform 2)