HIV-dual-GT
(Plasmid #122696)

• Purpose: Dual-fluorescence reporter to monitor the expression of HIV-1 early genes and late genes simultaneously.
• Depositing Lab: Klaus Überla
• Publication: Xiao et al mBio. 2021 Jan 19;12(1). pii: mBio.02525-20. doi: 10.1128/mBio.02525-20.

Backbone

• Vector backbone: pNL4-3
• Backbone manufacturer: Malcolm A. Martin Lab
• Backbone size w/o insert (bp): 14825
• Total vector size (bp): 16258
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mTagBFP2
• Species: Synthetic
• Insert Size (bp): 708
• GenBank ID: MH013372.1
• Promoter: HIV-1 LTR
• Tag / Fusion Protein:
  • PEST domain (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: 5' cgacccctcgtcacaagctagc 3'
• 3′ sequencing primer: 5' ccctatcttctagactatta 3'

Gene/Insert 2

• Gene/Insert name: DsRed-max
• Species: Synthetic
• Insert Size (bp): 672
• GenBank ID: FJ226078.1
• Promoter: HIV-1 LTR

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: 5' agatgggtggcgcggccgct 3'
• 3′ sequencing primer: 5' ttctaggtctcgagttacta 3'

Resource Information

• Supplemental Documents:
  • HIV-dual-GT.gb
  • Construction and characterization of HIV-dual-GT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry