Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HIV-dual-GT
(Plasmid #122696)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122696 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNL4-3
  • Backbone manufacturer
    Malcolm A. Martin Lab
  • Backbone size w/o insert (bp) 14825
  • Total vector size (bp) 16258
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mTagBFP2
  • Species
    Synthetic
  • Insert Size (bp)
    708
  • GenBank ID
    MH013372.1
  • Promoter HIV-1 LTR
  • Tag / Fusion Protein
    • PEST domain (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' cgacccctcgtcacaagctagc 3'
  • 3′ sequencing primer 5' ccctatcttctagactatta 3'
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DsRed-max
  • Species
    Synthetic
  • Insert Size (bp)
    672
  • GenBank ID
    FJ226078.1
  • Promoter HIV-1 LTR

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' agatgggtggcgcggccgct 3'
  • 3′ sequencing primer 5' ttctaggtctcgagttacta 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HIV-dual-GT was a gift from Klaus Überla (Addgene plasmid # 122696 ; http://n2t.net/addgene:122696 ; RRID:Addgene_122696)
  • For your References section:

    CRNKL1 Is a Highly Selective Regulator of Intron-Retaining HIV-1 and Cellular mRNAs. Xiao H, Wyler E, Milek M, Grewe B, Kirchner P, Ekici A, Silva ABOV, Jungnickl D, Full F, Thomas M, Landthaler M, Ensser A, Uberla K. mBio. 2021 Jan 19;12(1). pii: mBio.02525-20. doi: 10.1128/mBio.02525-20. 10.1128/mBio.02525-20 PubMed 33468685