tUI-HA
(Plasmid #122662)

• Purpose: Express tUI-HA protein in E. coli
• Depositing Lab: Robert Cohen
• Publication: Choi et al Nat Methods. 2019 Jul 15. pii: 10.1038/s41592-019-0469-9. doi: 10.1038/s41592-019-0469-9.

Backbone

• Vector backbone: pET28a
• Backbone size w/o insert (bp): 5293
• Total vector size (bp): 5839
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For protein expression, 8 hour incubation at 30 degree with 0.4 mM IPTG is optimal.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tUI-HA
• Species: H. sapiens (human)
• Insert Size (bp): 546
• Promoter: T7 promoter
• Tags / Fusion Proteins:
  • His-tag (N terminal on backbone)
  • HA-tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA