Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-sgTel
(Plasmid #122659)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122659 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Total vector size (bp) 8890
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BFP
  • gRNA/shRNA sequence
    TTAGGGTTAGGGTTAGGGTTA

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was modified from Addgene plasmid #60905 (Tanenbaum et al., Cell, 2014). Details can be found under the methods section (subsection constructs) of our manuscript.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-sgTel was a gift from Clifford Brangwynne (Addgene plasmid # 122659 ; http://n2t.net/addgene:122659 ; RRID:Addgene_122659)
  • For your References section:

    Liquid Nuclear Condensates Mechanically Sense and Restructure the Genome. Shin Y, Chang YC, Lee DSW, Berry J, Sanders DW, Ronceray P, Wingreen NS, Haataja M, Brangwynne CP. Cell. 2018 Nov 29;175(6):1481-1491.e13. doi: 10.1016/j.cell.2018.10.057. 10.1016/j.cell.2018.10.057 PubMed 30500535