pLV-sgTel
(Plasmid
#122659)
-
PurposeExpresses sgRNA for telomere repeats with fluorescent indicator BFP and puromycin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 8890
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP
-
gRNA/shRNA sequenceTTAGGGTTAGGGTTAGGGTTA
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was modified from Addgene plasmid #60905 (Tanenbaum et al., Cell, 2014). Details can be found under the methods section (subsection constructs) of our manuscript.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-sgTel was a gift from Clifford Brangwynne (Addgene plasmid # 122659 ; http://n2t.net/addgene:122659 ; RRID:Addgene_122659) -
For your References section:
Liquid Nuclear Condensates Mechanically Sense and Restructure the Genome. Shin Y, Chang YC, Lee DSW, Berry J, Sanders DW, Ronceray P, Wingreen NS, Haataja M, Brangwynne CP. Cell. 2018 Nov 29;175(6):1481-1491.e13. doi: 10.1016/j.cell.2018.10.057. 10.1016/j.cell.2018.10.057 PubMed 30500535
Map uploaded by the depositor.
