-
PurposetRNA synthetase/tRNA pair for the incorporation of unnatural amino acid into proteins in mammalian cells in response to the amber codon TAG.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePylRS-AF, Pyl-tRNACUA
-
SpeciesMethanosarcina mazei
-
MutationTyrosine 306 changed to Alanine, Tyrosine 384 changed to Phenylalanine
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Peng R. Chen, Peking University, China
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mm-PylRS-AF/Pyl-tRNACUA was a gift from Howard Hang (Addgene plasmid # 122650 ; http://n2t.net/addgene:122650 ; RRID:Addgene_122650) -
For your References section:
IFITM3 directly engages and shuttles incoming virus particles to lysosomes. Spence JS, He R, Hoffmann HH, Das T, Thinon E, Rice CM, Peng T, Chandran K, Hang HC. Nat Chem Biol. 2019 Jan 14. pii: 10.1038/s41589-018-0213-2. doi: 10.1038/s41589-018-0213-2. 10.1038/s41589-018-0213-2 [pii] PubMed 30643282