Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET15b-His-3C-irisin
(Plasmid #122612)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122612 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET15b
  • Backbone manufacturer
    novagen
  • Total vector size (bp) 2718
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use C41(DE3) strain for expression. It will give higher expression than BL21(DE3).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    irisin (ectodomain of FNDC5)
  • Alt name
    FNDC5
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
  • Insert Size (bp)
    426
  • GenBank ID
    NM_027402.3
  • Entrez Gene
    Fndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
  • Promoter T7 polymerase
  • Tag / Fusion Protein
    • Nt: histag-3C protease site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer T7 promotor primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 terminator primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET15b-His-3C-irisin was a gift from Harold Erickson (Addgene plasmid # 122612 ; http://n2t.net/addgene:122612 ; RRID:Addgene_122612)
  • For your References section:

    Irisin - a myth rather than an exercise-inducible myokine. Albrecht E, Norheim F, Thiede B, Holen T, Ohashi T, Schering L, Lee S, Brenmoehl J, Thomas S, Drevon CA, Erickson HP, Maak S. Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889. 10.1038/srep08889 PubMed 25749243