pET15b-His-3C-irisin
(Plasmid #122612)

• Purpose: Expresses in E. coli: human irisin with Nt histag and 3C protease site for cleavage
• Depositing Lab: Harold Erickson
• Publication: Albrecht et al Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889.

Backbone

• Vector backbone: pET15b
• Backbone manufacturer: novagen
• Total vector size (bp): 2718
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use C41(DE3) strain for expression. It will give higher expression than BL21(DE3).
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: irisin (ectodomain of FNDC5)
• Alt name: FNDC5
• Species: H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
• Insert Size (bp): 426
• GenBank ID: NM_027402.3
• Entrez Gene: Fndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
• Promoter: T7 polymerase
• Tag / Fusion Protein:
  • Nt: histag-3C protease site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: T7 promotor primer TAATACGACTCACTATAGGG
• 3′ sequencing primer: T7 terminator primer GCTAGTTATTGCTCAGCGG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry