Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGT-Kh2
(Plasmid #122587)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122587 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGT-Kh2
  • Total vector size (bp) 5340
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    beta-lactamase/sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1614

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGTGGACTCAGAAAGATGAGA
  • 3′ sequencing primer GGCCGTTGCTTCGCAACGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See supplemental tables of the referenced paper for more information on each plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGT-Kh2 was a gift from Harris Wang (Addgene plasmid # 122587 ; http://n2t.net/addgene:122587 ; RRID:Addgene_122587)
  • For your References section:

    Metagenomic engineering of the mammalian gut microbiome in situ. Ronda C, Chen SP, Cabral V, Yaung SJ, Wang HH. Nat Methods. 2019 Feb;16(2):167-170. doi: 10.1038/s41592-018-0301-y. Epub 2019 Jan 14. 10.1038/s41592-018-0301-y PubMed 30643213