Skip to main content
Addgene

pAAV-hSyn-eGFP-SynaptoZip
(Plasmid #122525)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122525 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5974
  • Total vector size (bp) 7218
  • Modifications to backbone
    Substitution of the original promoter with hSyn
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP-SynaptoZip
  • Alt name
    GreenZip
  • Alt name
    GZ
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1278
  • GenBank ID
    MF797884
  • Entrez Gene
    Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
  • Promoter hSyn
  • Tags / Fusion Proteins
    • eGFP (N terminal on insert)
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCAGCACGACTTCTTCAAGTC
  • 3′ sequencing primer ATTGGTTAAATCCAAGGGAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-eGFP-SynaptoZip was a gift from Antonio Malgaroli (Addgene plasmid # 122525 ; http://n2t.net/addgene:122525 ; RRID:Addgene_122525)
  • For your References section:

    Functional mapping of brain synapses by the enriching activity-marker SynaptoZip. Ferro M, Lamanna J, Ripamonti M, Racchetti G, Arena A, Spadini S, Montesano G, Cortese R, Zimarino V, Malgaroli A. Nat Commun. 2017 Oct 31;8(1):1229. doi: 10.1038/s41467-017-01335-4. 10.1038/s41467-017-01335-4 PubMed 29089485