pAAV-hSyn-eGFP-SynaptoZip
(Plasmid #122525)

• Purpose: AAV expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by human Synapsin promoter
• Depositing Lab: Antonio Malgaroli
• Publication: Ferro et al Nat Commun. 2017 Oct 31;8(1):1229. doi: 10.1038/s41467-017-01335-4.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5974
• Total vector size (bp): 7218
• Modifications to backbone: Substitution of the original promoter with hSyn
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP-SynaptoZip
• Alt name: GreenZip
• Alt name: GZ
• Species: R. norvegicus (rat)
• Insert Size (bp): 1278
• GenBank ID: MF797884
• Entrez Gene: Vamp2 (a.k.a. RATVAMPB, RATVAMPIR, SYB, Syb2)
• Promoter: hSyn
• Tags / Fusion Proteins:
  • eGFP (N terminal on insert)
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GCAGCACGACTTCTTCAAGTC
• 3′ sequencing primer: ATTGGTTAAATCCAAGGGAAGG

Resource Information

• Supplemental Documents:
  • pAAV-hSyn-eGFP-SynaptoZip-WPRE.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry