K401-iLid
(Plasmid #122484)

• Purpose: Component of optically-induced motor dimerization system
• Depositing Lab: Matt Thomson
• Publication: Ross et al Nature. 2019 Aug;572(7768):224-229. doi: 10.1038/s41586-019-1447-1. Epub 2019 Aug 7.

Backbone

• Vector backbone: pT7-7
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 4154
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kinesin 1-401 iLid His tag
• Alt name: K401-iLid-H6
• Species: D. melanogaster (fly), Synthetic
• Insert Size (bp): 1713
• Mutation: Kinesin amino acids 1-401
• GenBank ID:
• Promoter: T7
• Tags / Fusion Proteins:
  • iLid (C terminal on insert)
  • His6 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • K401-iLID.gb
• A portion of this plasmid was derived from a plasmid made by: Jeff Gelles, Brian Kuhlman

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry