HA-IFITM3-F8-TAG
(Plasmid
#122475)
-
Purposeexpresses human IFITM3 with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122475 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4191
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesH. sapiens (human)
-
MutationChanged Phenylalanine 8 to amber codon
-
Entrez GeneIFITM3 (a.k.a. 1-8U, DSPA2b, IP15)
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-IFITM3-F8-TAG was a gift from Howard Hang (Addgene plasmid # 122475 ; http://n2t.net/addgene:122475 ; RRID:Addgene_122475) -
For your References section:
IFITM3 directly engages and shuttles incoming virus particles to lysosomes. Spence JS, He R, Hoffmann HH, Das T, Thinon E, Rice CM, Peng T, Chandran K, Hang HC. Nat Chem Biol. 2019 Jan 14. pii: 10.1038/s41589-018-0213-2. doi: 10.1038/s41589-018-0213-2. 10.1038/s41589-018-0213-2 [pii] PubMed 30643282