pMCRW1
(Plasmid #122462)

• Purpose: Human NPM-ALK fusion protein gene in pET28a bacterial expression plasmid. Production of recombinant human NPM-ALK fusion protein in E. coli Bl21 Rosetta2 cells
• Depositing Lab: Richard C. Willson
• Publication: Kourentzi et al Sci Rep. 2020 Mar 19;10(1):5078. doi: 10.1038/s41598-020-61936-w.

Backbone

• Vector backbone: pET28a
• Backbone size w/o insert (bp): 5289
• Total vector size (bp): 7351
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NPM-ALK fusion protein
• Alt name: NPM-ALK
• Alt name: Anaplastic Large Cell Lymphoma characteristic fusion protein
• Species: H. sapiens (human)
• Insert Size (bp): 2062
• Entrez Gene: ALK (a.k.a. ALK1, CD246, NBLST3)
• Entrez Gene: NPM1 (a.k.a. B23, NPM)
• Promoter: T7lac promoter
• Tag / Fusion Protein:
  • His Tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: taatacgactcactatagggg
• 3′ sequencing primer: gctagttattgctcagcgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry