Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCRW1
(Plasmid #122462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122462 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5289
  • Total vector size (bp) 7351
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NPM-ALK fusion protein
  • Alt name
    NPM-ALK
  • Alt name
    Anaplastic Large Cell Lymphoma characteristic fusion protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2062
  • Entrez Gene
    ALK (a.k.a. ALK1, CD246, NBLST3)
  • Entrez Gene
    NPM1 (a.k.a. B23, NPM)
  • Promoter T7lac promoter
  • Tag / Fusion Protein
    • His Tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactatagggg
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCRW1 was a gift from Richard C. Willson (Addgene plasmid # 122462 ; http://n2t.net/addgene:122462 ; RRID:Addgene_122462)
  • For your References section:

    Recombinant expression, characterization, and quantification in human cancer cell lines of the Anaplastic Large-Cell Lymphoma-characteristic NPM-ALK fusion protein. Kourentzi K, Crum M, Patil U, Prebisch A, Chavan D, Vu B, Zeng Z, Litvinov D, Zu Y, Willson RC. Sci Rep. 2020 Mar 19;10(1):5078. doi: 10.1038/s41598-020-61936-w. 10.1038/s41598-020-61936-w PubMed 32193476