Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSiren_EGFP-shHmga2#2
(Plasmid #122290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122290 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSiren_GFP
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Knockdown shRNA for mouse Hmga2
  • gRNA/shRNA sequence
    GCAGTGACCAGTTATTCTTAA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSiren_EGFP-shHmga2#2 was a gift from Yukiko Gotoh (Addgene plasmid # 122290 ; http://n2t.net/addgene:122290 ; RRID:Addgene_122290)
  • For your References section:

    HMGA regulates the global chromatin state and neurogenic potential in neocortical precursor cells. Kishi Y, Fujii Y, Hirabayashi Y, Gotoh Y. Nat Neurosci. 2012 Aug;15(8):1127-33. doi: 10.1038/nn.3165. 10.1038/nn.3165 PubMed 22797695