pLenti-TK-Firefly-cjBCCIP
(Plasmid #122278)

• Purpose: Lentiviral vector for stable expression of Firefly luciferase.
• Depositing Lab: Demián Cazalla
• Publication: Gorbea et al Elife. 2019 Sep 20;8. pii: 50530. doi: 10.7554/eLife.50530.

Backbone

• Vector backbone: pLenti-TK-Firefly-Control
• Backbone size w/o insert (bp): 9199
• Total vector size (bp): 9507
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly luciferase
• Species: Synthetic; Pyrophorus plagiophthalamus
• Insert Size (bp): 1653
• GenBank ID: ACJ37466.1

Gene/Insert 2

• Gene/Insert name: cjBCCIP 3'UTR
• Species: Callithrix jacchus
• Insert Size (bp): 312
• GenBank ID: XM_002756702

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CCTGACAGAAACAACCAGCGC
• 3′ sequencing primer: gGGGACCCaaaagaaaaggggggaGGGGATACCCCCTAGAGCCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry