-
PurposeSP-dCas9-KRAB-MeCP2 with doxycycline-inducible expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePB-TRE
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9-KRAB-MeCP2
-
SpeciesSynthetic
-
Insert Size (bp)5346
-
Tag
/ Fusion Protein
- dCas9-KRAB-MeCP2 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCCAAATTCTCGATTCACGC
- 3′ sequencing primer CTCGGTGGGGTATCGACAGA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.06.28.449297v5 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE-dCas9-KRAB-MeCP2 was a gift from Andrea Califano (Addgene plasmid # 122267 ; http://n2t.net/addgene:122267 ; RRID:Addgene_122267) -
For your References section:
Interrogation of genome-wide, experimentally dissected gene regulatory networks reveals mechanisms underlying dynamic cellular state control. Tan X, Worley J, Turunen M, Wong K, Fernández EC, Paull E, Jones S, Wang J, Noh H, Salvatori B, Chavez A, Califano A. bioRxiv 2021.06.28.449297 10.1101/2021.06.28.449297