pMB34
(Plasmid #122245)

• Purpose: Lentivirus delivery for stable expression of LbCas12a-VPR
• Depositing Lab: Darjus Tschaharganeh
• Publication: Breinig et al Nat Methods. 2019 Jan;16(1):51-54. doi: 10.1038/s41592-018-0262-1. Epub 2018 Dec 17.

Backbone

• Vector backbone: pLL3.3
• Backbone size w/o insert (bp): 7301
• Total vector size (bp): 12695
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mammalian codon-optimized Lachnospiraceae bacterium Cas12a fused to VPR activator
• Alt name: LbCpf1
• Species: Synthetic
• Insert Size (bp): 5422
• Promoter: EFs
• Tags / Fusion Proteins:
  • VPR activator (C terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ggaaagtgatgtcgtgtactgg
• 3′ sequencing primer: ATGCTCCAGACTGCCTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: LbCas12a was amplified from pY109 (lenti-LbCas12a, Addgene plasmid # 84740 )

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry