Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Ad:2CMV_A2R2-N25Ctr
(Plasmid #122243)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122243 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pShuttle-CMV
  • Backbone size w/o insert (bp) 7469
  • Total vector size (bp) 12749
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    C-terminal end of Nesprin-3 w/o Kash
  • Alt name
    Syne3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    120
  • Mutation
    deleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGGCCAACAACTTCGCCCGCTCCTTTGCGCTCATGCTTCGGTACAATGGCCCCCCGCCCACC)
  • Entrez Gene
    Syne3 (a.k.a. KASH3, nesprin-3)
  • Promoter CMV
  • Tags / Fusion Proteins
    • mNeptune2.5 (N terminal on insert)
    • Signal Peptide (TOR1A, NM_000113.2) (N terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Actinin alpha 2
  • Alt name
    Actn2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2682
  • GenBank ID
    NM_033268.4
  • Entrez Gene
    Actn2 (a.k.a. 1110008F24Rik)
  • Promoter CMV
  • Tag / Fusion Protein
    • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 2

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dominant negative Kash construct is comprised of the C-terminal end of Nesprin-3, including the transmembrane but excluding the Kash domain, and fused to Nesprin2.5 for visual location and to the signal peptide of TOR1A (NM_000113.2) for membrane integration. This vector is meant as integration defective control (into LINC complex) for the vector Ad:2CMV_A2R2-N25K3 (122242). Please note the L451V substitution in Actinin alpha 2 has no functional consequences.

Please visit https://www.biorxiv.org/content/early/2018/10/29/455600 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ad:2CMV_A2R2-N25Ctr was a gift from Corey Neu (Addgene plasmid # 122243 ; http://n2t.net/addgene:122243 ; RRID:Addgene_122243)
  • For your References section:

    Nuclear deformation guides chromatin reorganization in cardiac development and disease. Seelbinder B, Ghosh S, Schneider SE, Scott AK, Berman AG, Goergen CJ, Margulies KB, Bedi KC Jr, Casas E, Swearingen AR, Brumbaugh J, Calve S, Neu CP. Nat Biomed Eng. 2021 Dec;5(12):1500-1516. doi: 10.1038/s41551-021-00823-9. Epub 2021 Dec 2. 10.1038/s41551-021-00823-9 PubMed 34857921