Ad:2CMV_A2R2-N25Ctr
(Plasmid #122243)

• Purpose: Expresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backbone
• Depositing Lab: Corey Neu
• Publication: Seelbinder et al Nat Biomed Eng. 2021 Dec;5(12):1500-1516. doi: 10.1038/s41551-021-00823-9. Epub 2021 Dec 2.

Backbone

• Vector backbone: pShuttle-CMV
• Backbone size w/o insert (bp): 7469
• Total vector size (bp): 12749
• Vector type: Mammalian Expression, Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: C-terminal end of Nesprin-3 w/o Kash
• Alt name: Syne3
• Species: M. musculus (mouse)
• Insert Size (bp): 120
• Mutation: deleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGGCCAACAACTTCGCCCGCTCCTTTGCGCTCATGCTTCGGTACAATGGCCCCCCGCCCACC)
• Entrez Gene: Syne3 (a.k.a. KASH3, nesprin-3)
• Promoter: CMV
• Tags / Fusion Proteins:
  • mNeptune2.5 (N terminal on insert)
  • Signal Peptide (TOR1A, NM_000113.2) (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a

Gene/Insert 2

• Gene/Insert name: Actinin alpha 2
• Alt name: Actn2
• Species: M. musculus (mouse)
• Insert Size (bp): 2682
• GenBank ID: NM_033268.4
• Entrez Gene: Actn2 (a.k.a. 1110008F24Rik)
• Promoter: CMV
• Tag / Fusion Protein:
  • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Dominant negative Kash construct is comprised of the C-terminal end of Nesprin-3, including the transmembrane but excluding the Kash domain, and fused to Nesprin2.5 for visual location and to the signal peptide of TOR1A (NM_000113.2) for membrane integration. This vector is meant as integration defective control (into LINC complex) for the vector Ad:2CMV_A2R2-N25K3 (122242). Please note the L451V substitution in Actinin alpha 2 has no functional consequences.

Please visit https://www.biorxiv.org/content/early/2018/10/29/455600 for BioRxiv preprint.