pBA950
(Plasmid #122239)

• Purpose: CROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.
• Depositing Lab: Jonathan Weissman
• Publication: Replogle et al Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30.

Backbone

• Vector backbone: CROPseq-Guide-Puro (Addgene, #86708)
• Total vector size (bp): 8522
• Modifications to backbone: First, an intermediate vector was constructed by replacing the existing selectable marker in CROPseq-Guide-Puro with BFP (synthesized dsDNA inserted by Gibson assembly using PstI and MluI). Then pBA950 was made by replacing the entire human U6-driven sgRNA expression cassette with the sgRNA expression cassette from pU6-sgRNA EF1Alpha-puro-T2A-BFP (synthesized dsDNA inserted between PpuMI and NcoI by Gibson assembly). This cassette is driven by a modified mouse U6 promoter and encodes a BlpI-containing sgRNA(F+E) programmed with EGFP-NT2.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: BFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
• gRNA/shRNA sequence: EGFP-NT2
• Species: Synthetic

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagcacaaaaggaaactcacc
• 3′ sequencing primer: TCAAGTTGATAACGGACTAGCC

Resource Information

• Supplemental Documents:
  • pBA950.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry