pBA904
(Plasmid #122238)

• Purpose: Lentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.
• Depositing Lab: Jonathan Weissman
• Publication: Replogle et al Nat Biotechnol. 2020 Aug;38(8):954-961. doi: 10.1038/s41587-020-0470-y. Epub 2020 Mar 30.

Backbone

• Vector backbone: pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955)
• Total vector size (bp): 8914
• Modifications to backbone: A modified sgRNA (with capture sequence 1 in stem loop 2 of the constant region/tracr) was inserted using BlpI and XhoI sites.
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin ; BFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: sgRNA with cs1 in stem loop 2 of the constant region
• gRNA/shRNA sequence: sgNegCtrl3 - non-targeting
• Species: Synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BlpI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: cagcacaaaaggaaactcacc

Resource Information

• Supplemental Documents:
  • pBA904_gba405.gb
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry