Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PCDHGC5 sh1 3m shRNA
(Plasmid #122228)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122228 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    mU6pro
  • Vector type
    RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCDHGC5 shRNA
  • gRNA/shRNA sequence
    UCUUCACUGCUUAAGCUGGAU
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Pcdhgc5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was originally cloned in Angel de Blas's lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCDHGC5 sh1 3m shRNA was a gift from Angel de Blas (Addgene plasmid # 122228 ; http://n2t.net/addgene:122228 ; RRID:Addgene_122228)
  • For your References section:

    Molecular and functional interaction between protocadherin-gammaC5 and GABAA receptors. Li Y, Xiao H, Chiou TT, Jin H, Bonhomme B, Miralles CP, Pinal N, Ali R, Chen WV, Maniatis T, De Blas AL. J Neurosci. 2012 Aug 22;32(34):11780-97. doi: 10.1523/JNEUROSCI.0969-12.2012. 10.1523/JNEUROSCI.0969-12.2012 PubMed 22915120