PCDHGC5 sh1 3m shRNA
(Plasmid
#122228)
-
PurposeNegative control shRNA (with 3-point mutations), for plasmid 122227: targeting Protocadherin gamma C5 mRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemU6pro
-
Vector typeRNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCDHGC5 shRNA
-
gRNA/shRNA sequenceUCUUCACUGCUUAAGCUGGAU
-
SpeciesR. norvegicus (rat)
-
Entrez GenePcdhgc5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert was originally cloned in Angel de Blas's lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCDHGC5 sh1 3m shRNA was a gift from Angel de Blas (Addgene plasmid # 122228 ; http://n2t.net/addgene:122228 ; RRID:Addgene_122228) -
For your References section:
Molecular and functional interaction between protocadherin-gammaC5 and GABAA receptors. Li Y, Xiao H, Chiou TT, Jin H, Bonhomme B, Miralles CP, Pinal N, Ali R, Chen WV, Maniatis T, De Blas AL. J Neurosci. 2012 Aug 22;32(34):11780-97. doi: 10.1523/JNEUROSCI.0969-12.2012. 10.1523/JNEUROSCI.0969-12.2012 PubMed 22915120