mycBioID-pBabePuro-myc-BirA*HRASG12V
(Plasmid
#122214)
-
PurposeStably expresses myc-BirA* fused to HRASG12V in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemycBioID-pBABE-puro
- Backbone size w/o insert (bp) 6213
- Total vector size (bp) 6780
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHRASG12V
-
Alt nameHRAS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)567
-
Mutationchanged G12 to V
-
GenBank ID3265
-
Entrez GeneHRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)
-
Tag
/ Fusion Protein
- myc-BirA* (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTATCCAGCCCTCAC
- 3′ sequencing primer ACCCTAACTGACACACATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mycBioID-pBabePuro-myc-BirA*HRASG12V was a gift from Christopher Counter (Addgene plasmid # 122214 ; http://n2t.net/addgene:122214 ; RRID:Addgene_122214) -
For your References section:
Interrogating the protein interactomes of RAS isoforms identifies PIP5K1A as a KRAS-specific vulnerability. Adhikari H, Counter CM. Nat Commun. 2018 Sep 7;9(1):3646. doi: 10.1038/s41467-018-05692-6. 10.1038/s41467-018-05692-6 [pii] PubMed 30194290